Cell Regul. had been cut with gene and codons 156C326 fused to the GFP-coding sequence. Cleavage of pDJ467 with locus results in production of Ste2-T326 tagged at the C terminus with GFP. pDJ467 was constructed by ligating the 4.5-kb DNA (pDJ320) as template and oligonucleotide primers PO-141 (GCGAAACTGCAGGGCGACAACTTCAAAAGGATAGGTTT) and PO-147 (CCACACCTACGAGTTCAA). pDJ469 (provided by Padhma Radhakrishnan, University of Massachusetts, Worcester, MA) is a yeast centromere plasmid that contains and directs synthesis of Ste2-T326 tagged at the C terminus with GFP. pDJ469 was created by cloning the codons 259C326 and and codons 156C326 fused to the triple HA-coding sequence. Cleavage of pDJ470 with locus results in production of Ste2-T326 tagged at the C terminus with the triple HA epitope. pDJ470 was created in two Dehydrocholic acid steps. In the first step, primers PO-177 and PO-186 (GCGAAAGGTACCGGCGACAACTTCAAAAGGATAGGTTT) were used to amplify DNA encoding the triple HA epitope, and the PCR product was cloned between the codons 156C326 and the triple HA epitope) was PCR-amplified with oligonucleotide primers PO-140 and PO-141, and the locus. pDJ320 Rabbit Polyclonal to KAPCB was digested with locus. Production of relevant proteins was confirmed by Western blotting. Yeast strains were transformed with plasmids by using standard techniques (Soni allele into integrating plasmid pDJ251 and then introducing it into the chromosomal locus of strain DJ211-5-3 by using the two-step gene replacement described previously (Schandel and Jenness, 1994 ). Table 1 Yeast strains used in this study inhibits -factor degradation (Sprague and Herskowitz, 1981 ). Temperature-sensitive mutation suppresses amber mutations and at 22C. marker.? Media Liquid and solid media were prepared as previously described (Jenness aspartate transcarbamoylase (ATCase) (from Y.R. Yang and H.K. Schachman, University of California, Berkeley, Berkeley, Dehydrocholic acid CA) or for the carboxy-terminal portion of the -factor receptor Ste2 (Konopka HA epitope (HA.11) were from Babco, Berkeley Antibody, Richmond, CA. Peroxidase-conjugated goat anti-rabbit secondary antibodies were purchased from Life Technologies, Baltimore, MD. Peroxidase-conjugated goat anti-mouse secondary antibodies, purified mouse immunoglobulin and for 5 min to remove insoluble material. In each experiment, an equivalent number of cells was processed for each immunoprecipitation reaction; however, for the experiments in which the cultures had been treated with -factor; the extracts were corrected for protein concentration. Bicinchoninic acid protein assay (for 5 s. Beads were washed four times with IP buffer and extracted with concentrated SDS sample buffer for 10 min at 37C. Samples were centrifuged at 13,000 for 5 min. The proteins were resolved on 10% SDS-PAGE gels and detected by using immunoblotting methods. Peroxidase-conjugated goat anti-mouse or goat anti-rabbit F(ab)2 fragment was used as the secondary reagent. The results were quantified by using laser-scanning densitometry (Molecular Dynamics, Sunnyvale, CA). Glycerol Gradient Sedimentation Cells (2 109) were collected from exponentially growing cultures that had been untreated or treated with 10?7 M -factor for 5 min. Crude membranes were extracted with Dehydrocholic acid and mixed with 4.5 g of BSA (4.3S), 5 g of mouse IgG (7S), and 10 g of ATCase (11.7S) as internal marker proteins. The mixture was applied to an 8C30% glycerol gradient in IP buffer and centrifuged in an SW50 rotor at 40,000 rpm for 14 h at 4C. Fourteen 350-l fractions were collected assayed for the presence of the tagged receptors and the marker proteins by using SDS-PAGE and immunoblotting methods. Fluorescence Microscopy Cultures were grown overnight at 34C to a.